|
Register | Sign In |
|
QuickSearch
EvC Forum active members: 65 (9164 total) |
| |
ChatGPT | |
Total: 916,916 Year: 4,173/9,624 Month: 1,044/974 Week: 3/368 Day: 3/11 Hour: 0/2 |
Thread ▼ Details |
Member (Idle past 4936 days) Posts: 215 From: Brookfield, Wisconsin Joined: |
|
Thread Info
|
|
|
Author | Topic: Evolutionary Adaptation | |||||||||||||||||||||||
Someone who cares Member (Idle past 5781 days) Posts: 192 Joined: |
So there is nothing that prevents it. The preset genetic code would not allow it.
And when the code of the offspring is different from the code of either parent where did that come from? The parents with mutation. Thus there is no barrier to the code changing over time from generation to generation. The parents each gave half of their code, this recombined, there we have it, code for the offspring.
I've written lots of computer code where previous code was copied and one or two modifications were made to arrive at a different result. Mutations change the code. It's that simple, it's that basic, it's that undeniable. Mutations do alter the code, slightly. But they do not alter it in a way that would make evolution happen. Have you read my essay yet?
But that is change in species over time, change within "kind" if you will for they were horses before they had only one hoof. And once again -- your OPINION has no effect on the reality around you. Enjoy. It's not just opinion, it's backed up beliefs. I have reason to believe what I believe in. "If you’re living like there is no God you’d better be right!" - Unknown
|
|||||||||||||||||||||||
RAZD Member (Idle past 1435 days) Posts: 20714 From: the other end of the sidewalk Joined: |
But the 9 never existed before, where did you get it from? It's an upside-down 6. That's how simple it is. we are limited in our ability to understand by our ability to understand RebelAAmerican.Zen[Deist
... to learn ... to think ... to live ... to laugh ... to share.
|
|||||||||||||||||||||||
arachnophilia Member (Idle past 1374 days) Posts: 9069 From: god's waiting room Joined: |
But you, are an intelligent being. You are conscience and smart when you do that. But evolution is supposed to be unguided, and random, without direction... no, not exactly. the words i italicized above were intentional. evolution has a random component, yes: variation. but the other component, selection is not random. it is based (in nature) on fitness and sexual factors. we can also artificially control it, ourselves. selection can be, and often is, an intelligent process.
But the 9 never existed before, where did you get it from? i added one. here's a better example, if you'd like: GACTGCGATAGCTAGCTAGA becomes GACTGGCGATAGCTAGCTAGA becomes: GACTGACGATAGCTAGCTAGA where did the extra G come from? duplication. where did the A come from? variation. duplication + variation = "new" data.
|
|||||||||||||||||||||||
RAZD Member (Idle past 1435 days) Posts: 20714 From: the other end of the sidewalk Joined: |
The preset genetic code would not allow it. HOW??? You can't just keep saying this as if that alone prevents anything from happening. This is just assertion after assertion after assertion of the same ignorance and incredulity -- and NOT A SINGLE PIECE OF EVIDENCE.
The parents each gave half of their code, this recombined, there we have it, code for the offspring. But it doesn't always happen that way. Sometimes you get more from one than the other, sometimes you get duplications of whole chromosomes. You also have mutations that the offspring gets from badly copied code that results in code neither parent had. You are just plain absolutely wrong that it is so limited, and the evidence can be found in any real study of genetics.
Mutations do alter the code, slightly. But they do not alter it in a way that would make evolution happen. So you SAY without any evidence to substantiate it and in spite of evidence to the contrary. Speciation has been observed in many situations, and the genetic reasons for these speciations have been studied. Guess what? They are caused by mutations in the genetic code of the species involved. YouAre Wrong. Again.
Have you read my essay yet? Yes, and I found it boring, full of misrepresentations and false claims, with unsubstantiated assertion piled on unsubstantiated assertion. An argument from incredulity and ignorance with many careless PRATTS that any serious study would have uncovered beforehand. Like your arguments here. Enjoy. ps added by edit
It's not just opinion, it's backed up beliefs. What a logical HOWLER! Beliefs are not evidence. Furthermore what you said in effect is:
It's not just opinion (what you think is true) it's backed up by belief (what you think is true).
ROFLOL. Edited by RAZD, : added ps we are limited in our ability to understand by our ability to understand RebelAAmerican.Zen[Deist
... to learn ... to think ... to live ... to laugh ... to share.
|
|||||||||||||||||||||||
kuresu Member (Idle past 2543 days) Posts: 2544 From: boulder, colorado Joined: |
you missed it. I didn't give you all the transitionals. had I done it using arachniphilia's method, I would have shown you 603 posts, with a single letter change, if not more, and I would arrive at the new message, or a different one. If done by 10 characters, it would take at least 61 generations of mutations. If done by a hundred per, it would take at least 7 generations. I didn't, becuase I'm not going to spend the next week writing them out. Mutations work like this (at least base-pair subsitutions), and that is how, with many little steps, you can end up in with something different.
Oh, and are you going to reply to my disection of your essay? The post is one the evolution logic thread. All a man's knowledge comes from his experiences
|
|||||||||||||||||||||||
Lithodid-Man Member (Idle past 2961 days) Posts: 504 From: Juneau, Alaska, USA Joined: |
That's what meiosis is? The combination of genetic code from parents to form the code of the offspring? Are you sure? Meiosis? Hmmm... No, but it starts from meiosis. Meiosis divides the chromosome number in half. Then the combination takes place. Sorry for any confusion, I thought it's quite obvious. Ain't Google great? Look it up in seconds so it looks like you knew all along. Wonderful invention, that. Doctor Bashir: "Of all the stories you told me, which were true and which weren't?" Elim Garak: "My dear Doctor, they're all true" Doctor Bashir: "Even the lies?" Elim Garak: "Especially the lies"
|
|||||||||||||||||||||||
crashfrog Member (Idle past 1497 days) Posts: 19762 From: Silver Spring, MD Joined: |
But the point is, no new information can be added that would be for cells, tissues, organs, systems, body parts, etc, that the organism doesn't already have. I don't get why you think this is the case. Information is often added during the generation of gametes by meiosis. Mutations occur that are not corrected. Changes happen that are not undone. Information decends to the offspring that did not come from the parent. These aren't articles of faith, or something; these are direct observations of meiosis.
|
|||||||||||||||||||||||
Crue Knight Inactive Member |
quote:Yeah, pretty much trying to please both sides. But it doesn't work that way. If one is right then the other is wrong. Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End
|
|||||||||||||||||||||||
Crue Knight Inactive Member |
Sure could, and if that were true, if GOD actually did do that, then we need to abandon science and return to magic.
We cant explain how God created the animals and planets. There's no science in that. So all we can say is God did it. He spoke it, but we dont know how it all happened, because He is so much greater than us we dont understand how He is. Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End
|
|||||||||||||||||||||||
jar Member (Idle past 424 days) Posts: 34026 From: Texas!! Joined: |
We cant explain how God created the animals and planets. There's no science in that. So all we can say is God did it. He spoke it, but we dont know how it all happened, because He is so much greater than us we dont understand how He is. Perhaps you cannot explain how God created the animals and planets, but that does not mean that the rest of us can't. GOD does not ask us to check our brains at the door. Aslan is not a Tame Lion
|
|||||||||||||||||||||||
RAZD Member (Idle past 1435 days) Posts: 20714 From: the other end of the sidewalk Joined: |
quote:Yeah, pretty much trying to please both sides. But it doesn't work that way. If one is right then the other is wrong. Do you find spreading falsehoods to be "standing tall for the truth"? IF one side is right, then it doesn't need to misrepresent the other to show the truth eh? Welcome to the fray btw. Is that some microscope picture for your avatar? Edited by RAZD, : sp ell ing we are limited in our ability to understand by our ability to understand RebelAAmerican.Zen[Deist
... to learn ... to think ... to live ... to laugh ... to share.
|
|||||||||||||||||||||||
fallacycop Member (Idle past 5551 days) Posts: 692 From: Fortaleza-CE Brazil Joined: |
Someone who cares writes: Often times in this fora creationists make claims to the effect that no new information can be added to the genetic code. I wonder if they all come to that bogus position independently or if they read it off some missinformed source. Did you read this nonsense somewhere else and is regorgitating it at us? Or did you come up with this jewel independently?
But the point is, no new information can be added that would be for cells, tissues, organs, systems, body parts, etc, that the organism doesn't already have.
|
|||||||||||||||||||||||
ramoss Member (Idle past 642 days) Posts: 3228 Joined: |
If you don't know how he did it, why are you ruling out that god did it throughselection with a filter of natural selection>?
|
|||||||||||||||||||||||
Crue Knight Inactive Member |
Welcome to the fray btw. Is that some microscope picture for your avatar?
The fray?Lol, yeah. It's a bubble in middle of being adjusted to the light on the camera. Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End
|
|||||||||||||||||||||||
Crue Knight Inactive Member |
If you don't know how he did it, why are you ruling out that god did it throughselection with a filter of natural selection>?
I dont believe in evolution. Im a creationist. I believe the universe was created in 7 days, 13,000 years ago. (Ill get to how I got 13,000 years later on my own topic)So yeah, I dont believe in natural selection...actually against it. I was just reffering to Theistic-Evolutionists that believes in God and evolution and tries to tie the sides together. Read "Time Has an End" by, H. Camping for great evdence that the Bible is true and the word of God. You can read it online at Time Has An End
|
|
|
Do Nothing Button
Copyright 2001-2023 by EvC Forum, All Rights Reserved
Version 4.2
Innovative software from Qwixotic © 2024