The Origin of Novelty

You evolutionists sometimes think that just by REPLYING you have made some sense, your answer did not deal with the question at all. It points to selection pressure on favorable alleles, which is actually MY point. Good point, if you could convince me that these types of substitutions do occur naturally you would have an argument that beneficial mice mutation can be observed, even if not in the mice study presented. How exactly does the substitution occur in nature?

Did you read the reply?Right away, one thing is very appararent. There is extremely strong negative selection against the dark allele in the light colored desert that separates the two lava fields. If the dark allele had emerged in the light colored desert it would have disappeared in just a few generations. The only way that the allele could survive is if the mice carrying the mutation moved into the black lava fields.So how old are the lava fields? Very recent, geologically speaking. They are around 1 million years old, much younger than the desert landscape that the ancestral populations adapted to.And that is just one of the points illustrating that the allele came about through mutation in an ancestral population that did not have that allele.

What nested hierarchies? You fail to show me any. (or are you referring to the mole/reptile?)

Start here:Animals

Aaaah , so your whole theory is based on your ASSUMPTION that the original population did not travel far even over a million years. You are assuming the entire planet had a light landscape and so only light alleles existed. Mice can travel far in a thousand years, let alone a million years, logically all the alleles were not confined to that region. Your conclusions are a Huge assumption, and not a logical one either.

Not the entire planet, just the area containing the ancestral population. This area was light brown, and dark alleles could not survive in these areas and so were eliminated quickly when they did appear. It wasn't until the recent appearance of black lava fields that these alleles had somewhere to survive.This is also backed up by the lack of sequence variation within the dark allele compared to the light allele. We observe that they are confined to those areas. This is a fact. The dark allele genotypes on the two different lava fields are DIFFERENT. This demonstrates that the dark allele can not travel very far from the lava field. The dark fur color had to evolve at least twice in independent events in different genes.If what you claim is true then we should see the same mutations in both populations, but we don't.Edited by Taq, : No reason given.

But you *are* following Bolder-dash's example. I asked that there be no replies in this thread. I provided a link to the thread where complaints should be posted (Report Discussion Problems Here 4.0(NOT A DISCUSSION TOPIC!!!)[/color]). Yet you replied in this thread. You are precisely following Bolder-dash's example. If you would like to be suspended then simply post one more message about moderation in this thread. Despite all his complaints about how biased moderation is here, Bolder-dash has never been suspended for his positions on any issue. He has only been suspended for posting his complaints to the wrong thread, and if you continue in the same vein then it will be how you will also get suspended. It has nothing to do with biased moderation. If you have a complaint about Bluegenes participation in this thread then please take it to the Report Discussion Problems Here 4.0(NOT A DISCUSSION TOPIC!!!)[/color] thread. His last reply to you was Message 623, so please be specific, quoting the specific places where he is being evasive or mysterious, and explain why you didn't note anything about his being evasive or mysterious in your reply to him in Message 646, and why you haven't replied to Taq. Then this impression would be wrong. I only intervened after there was an extended exchange between Bolder-dash and Coyote that was drifting far off-topic in violation of varioius Forum Guidelines, see my Message 529 and follow the exchange forward. I eventually invited both you and Bolder-dash to PM me to explain why I'm incorrect about what I thought was off-topic, neither of you has done so. This is good advice for everyone. You might consider that your feelings of biased treatment actually derive from your own biases. That you've been unable to point to anything specific says that you're responding more to feelings than to facts.But what we have here is not an issue of creation/evolution. The only participants violating plain and simple Forum Guidelines having nothing to do with evolution or creationism in this thread are you and Bolder-dash. It isn't rocket science. Please stop posting off-topic in this thread. If you have legitimate complaints that you can support with actual quotes instead of vague complaints then take them to the Report Discussion Problems Here 4.0(NOT A DISCUSSION TOPIC!!!)[/color] thread. Any further off-topic posts to this thread will draw immediate suspensions, one day for you as a first offender after having been warned, more for Bolder-dash.

Hi, Mindspawn. As a point of order, my reasoning in this thread has mostly been inductive: that is, I use specific examples of engineering to infer a general process of design. There's a very important difference between "is not contradicted by reality" and "cannot be contradicted by reality."Are you aware of the concept of falsifiability? Basically, falsifiability means that, if an idea is wrong, it can be shown to be wrong. Being falsifiable is a good thing, because you know that, when you test it, it's possible to get a positive or negative result. That means, when you get a positive, you can be confident that it's a genuine positive.Your idea, on the other hand, is not falsifiable. So, you're effectively flipping a double-headed coin, and patting yourself on the back when you make it land on heads. This is a wonderful construct for protecting your cherished beliefs from criticism, but surely you can see that it's an inappropriate and dishonest way to determine whether an idea is accurate.Science works by constantly replacing our current ideas with newer, updated ideas. But, you can only replace an old idea if you can show that it isn't good enough to explain the evidence anymore. Since your coin can only land on heads, we don't ever know whether or not your coin-flipping technique actually works. You need a coin that could potentially land on tails: that way, landing on heads would actually mean something.For evolution, the coin actually has heads and tails. In the bats and birds example, the hypothesis based on evolution is that birds and bats evolved flight independently. This hypothesis predicts that bats' flight apparatus is derived from mammalian features, and that birds' flight apparatus is derived from avian/dinosaurian features. If some bats had flow-through lungs or feathers, or some birds had wing membranes or a diaphragm (i.e., if the coin landed on tails), I would be forced to reject my evolution hypothesis. Therefore, when the coin does not land on tails, I know that it's not just because I flipped a rigged coin: it's because the coin legitimately landed on the side I predicted it would land on.Can you do this with intelligent design? Can you show me that the coin you're using actually could conceivably land on tails? If not, then what possible meaning could all the heads you're flipping have?

That's not at all what I said. So far all of the irreducible complexity and complex specified information arguments I've heard of are utter failures.What I said was that if intelligent design was correct, then there might exist living structures that both ID and evolution theorists would agree cannot be evolved. On the other hand there are no such creations that we can say an intelligent designer could not or would not poof into existence.So in principle, ID proponents have a possible task using arguments of this type, while evolution proponents do not. That's all I have said. In practice, ID proponents cannot achieve success despite their lower burden.And of course my comment applies only to this one particular line of argument. Let's be real about this. First, there is no number of fossils that would ever convince you that life evolved. Every found fossil simply creates two new gaps for you to complain about. Secondly, we have all the fossils, aging, and genetic information to establish common descent to a high degree of certainty. Edited by NoNukes, : No reason given.Edited by NoNukes, : No reason given.

Is that all? I fail to see anything there that would favor long term hierarchies over design "groupings". But I keep saying this, and you keep claiming this great "nested hierarchy" argument without any backing. Why don't you show a tree of apes becoming humans and chimpanzees and orangutans? That would be more convincing.Edited by mindspawn, : No reason given.Edited by Admin, : Fix quote.

Already discussed at great lengths in previous posts, all of which you have not really responded to. I have shown that known human designs, such as vehicles, do not fall into a nested hierarchy. I have shown that nested hierarchies make zero sense with respect to design. Design groupings do not fall into a nested hierarchy.For example, there is absolutely no reason why a designer could not make a flying animal with feathers and mammary glands. None. There is absolutely no reason why a designer would need to stick with a nested hierarchy. None. The only process that we know of that will produce a nested hierarchy is descent with modification through evolutionary mechanisms. Then go here:HominidaeThat is the nested hierarchy for great apes and humans. If you had followed the original link through chordates, mammals, etc. you would have ended up on that page.Edited by Taq, : No reason given.

The "observed mechanism of mutation" generally causes observed damage to organisms. Mutations are favorable only when genes are damaged, or when in laboratory conditions they mimic areas of the genome that are widely known to have multiple copies. Thus there is NO OBSERVED mechanism that could produce the differences observed between the chimp and human.

Evidence please.Are the millions of mutations that separate chimps and humans damaging to both? Then show me one difference between chimps and humans that could not be produced by the observed mechanisms of mutation. Please show me actual sequence and show me the reasons as to why these mutations could not happen.

The lack of sequence variation could also be an indicator of a recent common ancestor for most of the dark mice (an allele that was introduced into the population) and all the dark mice in that area are descended from this outsider. You evolutionists seem to have a fixation with mutations. I guess you have to because you believe 95 percent of genomes are there through mutations so any flimsy argument is good enough for you. Its possible that brand new combinations of alleles are being created through variation via sexual reproduction, and any new favorable combination can be bred into a population. Thus what you see as definitely two mutations I see as two new allele combinations or new introductions from outside populations. You have not yet convinced me that these regions were always dry, isolated and always devoid of darkness (ash falls across the desert ) over your entire period. There is always a chance that during wetter or "darker soil" periods of history a darker breed of mice bred into the local population. These interbreeding moments between isolated populations of a species are commonly observed compared the rarity of favorable mutations. To assume a rare mutation rather than a common interbreeding moment reveals bias based on the evolutionary assumption that beneficial mutations were common.Edited by mindspawn, : No reason given.Edited by mindspawn, : No reason given.

mindspawn,Let's use some real sequence and see if your claims hold up. Here are two tiny bits of DNA from the human and chimp genomes, and I have also aligned them for you:

human
AAACCGGAACAACAGCACTGGAGTCGCCGGGCTCTCCGAG
AAACTGGAACAACAACACTGGAGTCGCCGGGCTCTCCGAG
chimp

As you can see, there are two substitutions that separate the two sequences. Please tell me why the observed mechanisms of mutation could not produce those two differences.Edited by Taq, : No reason given.