The Origin of Novelty

Just so that we are on the same page, here is the signaling cascade for melanin production. As you can see, the MC1R protein starts the cascade when it binds alpha-MSH: Caption: -MSH and MC1R receptor. -melanocyte stimulating hormone (-MSH) binds to its cognate receptor, melanocortin-1 receptor (MC1R). Ligand binding activates adenylate cyclase via coupled G-protein, which subsequently increases cytoplasmic cyclic AMP (cAMP). cAMP directly activates protein kinase A (PKA), which can transcriptionally activate MITF via activation of CREB. In parallel, cAMP can activate the Ras-Raf-MAPK-RSK cascade, which results in activation of MITF. MITF then modulates transcription of downstream pigmentation and proliferation genes. In melanoma, upregulated branches of this signaling pathway are indicated in black. The dashed arrow indicates modulation of transcriptional programming by MITF to favor tumorigenesis.
http://www.springerimages.com/....1007_978-3-7091-0371-5_7-0As you can see, there are several steps that control melanin production, and mutations in any of those genes can result in a change in melanin production.

Why should we give you more when you are ignoring the ones we have already given you?If you want to work ahead you can do a comparison of the human and chimp genomes. The differences between those genomes contain the beneficial mutations that were responsible for the novel functions found in humans and chimps.

No, you have dismissed it out of hand for no specific reason. How so? Please explain.If the mutations increase the binding affinity of MC1R to alpha-MSH this will increase the signal at low levels of alpha-MSH which will increase basal levels of melanin production. And yet we see parts of the system evolving right in front of our eyes. Because the differences between the genomes include beneficial mutations that conferred selectable novel functions.

If you don't mind, I will copy and paste my reply to Faith who asked the very same question:+++++++++++++++++++
1. Selection pressure. They surveyed many regions across the desert spanning Arizona and New Mexico. This survey included two black lava fields (one in Arizona and one in New Mexico) separated by 750 km, the areas immediatly around each lava field, and the desert between the two lava fields. What they found is that in between the lava fields there were no black mice. Even more, there were no alleles associated with dark fur even though light fur is the recessive allele (it only takes one dark allele to have dark fur). On the lava fields, the vast majority of mice had dark fur, and the dark allele was very, very common. In the areas directly around the dark lava fields there was a mixture of the two phenotypes. Right away, one thing is very appararent. There is extremely strong negative selection against the dark allele in the light colored desert that separates the two lava fields. If the dark allele had emerged in the light colored desert it would have disappeared in just a few generations. The only way that the allele could survive is if the mice carrying the mutation moved into the black lava fields.2. Variation of the alleles. From the paper, "Finally, the pattern of nucleotide variation observed among Mc1r alleles from the Pinacate site suggests the recent action of positive selection. Thirteen polymorphic sites are variable among the light haplotypes, whereas only one site is variable among the dark haplotypes (Table 1). " This means that the dark allele had gone through a much more recent selection event than the light allele. Therefore, the dark allele emerged after the light allele.3. Age of the lava fields. As was demonstrated above, you need black lava fields in order to have the dark allele. So how old are the lava fields? Very recent, geologically speaking. They are around 1 million years old, much younger than the desert landscape that the ancestral populations adapted to. As shown by both the nucleotide variation and selection pressures, the recent appearance of the lava fields is just one more piece of evidence showing that the dark allele arose through recent mutations in a population that did not have dark fur.
++++++++++++++++++++But just as a general question, what is it about the differences in the dark allele that make it impossible to produce through random mutations?

We can confirm that humans and chimps share a common ancestor, such as the comparison of ERV's. This is not a circular argument. We can also confirm that there is a signal of selection and random mutation within coding regions as shown by Ka/Ks values.But perhaps you can actually answer my question. Which of the differences between the human and chimp genomes could not be produced by the observed mechanism of mutation?

[qs]Exactly! Does anything in your evolutionist deductive reasoning require mutual exclusivity of the two concepts? But not just a failsafe plan, creativity and variety and beauty are also goals in their own right. Not everything has a practical purpose, some things in nature are beautiful, some are amazing in their sheer uniqueness. [/quote]None of which explains why life falls into a nested hierarchy. Paintings and sculptures are beautiful, but they do not fall into a nested hierarchy. Hand tools are useful, but they do not fall into a nested hierarchy. A nested hierarchy is not a logical pattern for a designer. Never has been. No, it shows that creationism is unfalsifiable which is a major weakness. It demonstrates that creationism is nothing more than a dogma. Why would those mutations fall into a nested hierarchy? You still have not explained this.

Did you read the reply?Right away, one thing is very appararent. There is extremely strong negative selection against the dark allele in the light colored desert that separates the two lava fields. If the dark allele had emerged in the light colored desert it would have disappeared in just a few generations. The only way that the allele could survive is if the mice carrying the mutation moved into the black lava fields.So how old are the lava fields? Very recent, geologically speaking. They are around 1 million years old, much younger than the desert landscape that the ancestral populations adapted to.And that is just one of the points illustrating that the allele came about through mutation in an ancestral population that did not have that allele.

Start here:Animals

Not the entire planet, just the area containing the ancestral population. This area was light brown, and dark alleles could not survive in these areas and so were eliminated quickly when they did appear. It wasn't until the recent appearance of black lava fields that these alleles had somewhere to survive.This is also backed up by the lack of sequence variation within the dark allele compared to the light allele. We observe that they are confined to those areas. This is a fact. The dark allele genotypes on the two different lava fields are DIFFERENT. This demonstrates that the dark allele can not travel very far from the lava field. The dark fur color had to evolve at least twice in independent events in different genes.If what you claim is true then we should see the same mutations in both populations, but we don't.Edited by Taq, : No reason given.

Already discussed at great lengths in previous posts, all of which you have not really responded to. I have shown that known human designs, such as vehicles, do not fall into a nested hierarchy. I have shown that nested hierarchies make zero sense with respect to design. Design groupings do not fall into a nested hierarchy.For example, there is absolutely no reason why a designer could not make a flying animal with feathers and mammary glands. None. There is absolutely no reason why a designer would need to stick with a nested hierarchy. None. The only process that we know of that will produce a nested hierarchy is descent with modification through evolutionary mechanisms. Then go here:HominidaeThat is the nested hierarchy for great apes and humans. If you had followed the original link through chordates, mammals, etc. you would have ended up on that page.Edited by Taq, : No reason given.

Evidence please.Are the millions of mutations that separate chimps and humans damaging to both? Then show me one difference between chimps and humans that could not be produced by the observed mechanisms of mutation. Please show me actual sequence and show me the reasons as to why these mutations could not happen.

mindspawn,Let's use some real sequence and see if your claims hold up. Here are two tiny bits of DNA from the human and chimp genomes, and I have also aligned them for you:

human
AAACCGGAACAACAGCACTGGAGTCGCCGGGCTCTCCGAG
AAACTGGAACAACAACACTGGAGTCGCCGGGCTCTCCGAG
chimp

As you can see, there are two substitutions that separate the two sequences. Please tell me why the observed mechanisms of mutation could not produce those two differences.Edited by Taq, : No reason given.

Outsider from where? As the data shows, the dark allele is strongly selected against, and this lava field is out in the middle of nowhere with no other black lava fields around it. The dark allele had to come from the light mice, and the lack of sequence variation demonstrates that the allele arose recently. They already tested that hypothesis in the paper. It is false. The dark phenotype is related to the mutated genotype. Then why were they unable to find populations of dark mice in the light brown desert? Don't forget that the dark allele is dominant so all you need is one copy to be dark. If that allele were present at all in those populations it would be seen, but it isn't. It is absent. The only bias is your refusal to even consider that a mutation causes changes in fur color.

Another poster has offered potential falsifications. It is dishonest on your part to discount them.Evolution predicts that we should see a nested hierarchy. Gross violations of that nested hierarchy in multiple species would falsify the theory. Period. It would seem to me that instead of discounting these falsifications that you would be actively looking for them and holding us accountable. If they are unique then what about all of the features that they share with other mammals? Where are the fossils with a mixture of derived mammal and bird features? Evolution is not based on Darwin's book. It is based on the evidence, the nested hierarchy being one of them. What is mythical about these transitional forms?http://www.theistic-evolution.com/transitional.html

So what logic have you presented that prevents mutations from causing the change in fur color? The other light colored rocks in the region date back to 10's of millions of years while the black lava dates to less than 2 million years. Interbreeding between which populations? How does this explain the difference in sequence variation between the light colored and dark allele? The interbreeding mechanisms was ruled out by the evidence. Mutations are also observed, and the other mechanisms were ruled out.