Abiogenesis

not my fault you can't understand the experiment or the point of that post.those experiments are not to explain how abiogenesis happened. or how DNA/RNA came about. The point is to show how they can be easily replicated.And you've shifted your goalposts--before you claimed that you needed a lot (all those organelles and whatnot) to replicate DNA/RNA. Now you are claiming that those experiments don't show how abiogenesis happened (which, by the way, is the truth, but it's not a fault of the experiments, because they were not designed or carried out to tackle the picture of how).

what do you mean by "genetic encryption"? I can't seem to figure that part of your post out.furthermore, why? do genes really need a purpose to exist?

simple rob. your claim that abiogenesis couldn't happen because DNA/RNA needs a whole lot of things for replication.If you can replicate it simply and easily, then you understand a single step of how life can hang on. Because if there is no replication process, then the first DNA/RNA doesn't stand much of a chance.

where to start, where to start . . . that's just plain wrong. you'll see my examples later in this post. meaning and information are two different concepts. wrong. you and I have different DNA. we both function. This is tantamount to saying that MAC OSX will not work because it is a variation of Windows Vista. Both work (well, once MAC OSX is released) he's never looked at DNA, apparently. This is the basic structure of DNA. (and yes, it's a cruddy schematic).phosphate--nitrogenous base (either A,C,T,G) --deoxy(ribose).Your DNA strand is but a bunch of these simple units put together, stack on top of eath other (so the [deoxy]ribose attaches to the phosphate of the second group).That's all DNA/RNA is. a repeat of that structure. how is this not a simple, repetitive structure?And what does being non-repeating have to do with information?
does:
AAACCCTTTGGG
or
ACTGTGACATGC
have information? what does this have to do with what has more information? or what information is?WORD . . .CATS. which one has more information?Does:
AAATTTCCCGGGAAATTTCCGGGAAATTTCCGGAATTCAGT
or
AAAAATTTTTCGCGCGTATATACGTACGTAATCGACGAAAT
have more information?and just how the heck does your post answer the question of
"why do genes need a purpose to exist?"?
Here's a hint. It doesn't. It totally evades and avoids the question, and brings up a different subject.mind actually answering the question?

---

"Have the Courage to Know!" --Immanuel Kant" One useless man is a disgrace. Two are called a law firm. Three or more are called a congress" --paraphrased, John AdamsWant to help give back to the world community? Did you know that your computer can help? Join the newest TeamEvC Climate Modelling to help improve climate predictions for a better tomorrow.

actually, MACS can use microsoft word.Johnson's point was that if you have variation, the variation cannot work. OSX and Vista are two different arrangements of code. Both work. You and I have two different arrangements of code, we both work. Better yet, a banana tree and humans have different arrangements of code (even different numbers of chromosomes). both work, both function.
and what about computers that use multiple operating systems (like crashfrog's--i think he uses 3 or four different OS's on the same comp--all make the comp work)? really? is:
100101010101000101011011111100000000101010101111101010101000000 000010101010100000000010101010101000000000010101010111111111110101 010101000
complex? bull. it's only 1's and 0's.
12345322343457842956456475912757496593201945674921096567401956745 647120956457942091265745649576091726547564792987651947
is more complex. it has more parts. (the numbers 0-9), whereas the previous statement only had 1 and 0.which do you think is more complex?and just what does all this have to with with abiogenesis not being possible? never mind the fact that you have not really answered any of my questions in the post you responded to.since you've made several jabs at me, I'll make two toward you: you never put much effort into thinking, period. the strong drink only makes your abyssmal understanding even worse.Edited by AdminAsgara, : fixed long text string to change page width....

and this has what to do with abiogenesis? near as I can tell, nothing.until you can answer that question, this whole tirade is off-topic.

you'll have to elucidate just why this is a problem for how abiogenesis happened.your answer: is bull. why? because you've changed your definition. first, you quoted johnson as to what information was. now you've got a different defintion, different idea. which are you going to use?and note--that definition does not give a purpose to information. only what information is.I'll repeat again, what does this have to do with abiogenesis? It's not a problem for abiogenesis.

abiogenesis = life created from non-life.
prebiogenesis = before the genesis of lifedo you see why prebiogenesis would not work? (hint--pre meaning before, and, when coupled with biogenesis, would never cover the genesis of life. because once you start the genesis, you have left the realm of "before".)also, while biology may depend upon physics and chemistry, it is a subject of its own--it deals with organisms, essentially. biology is basically bio=life ology = study of.this category is wholly separate from physics, chemistry, geology, and whatnot, which do not deal with organisms. I'll grant you that some cross--such as biochemistry (studying the chemistry that runs life) and paleontolgy (studying ancient life with geology mixed in). However, it is a separate field of its own.abiogenesis is the domain of biochemistry, specifically.and the "A" part of abiogenesis does not mean that those processes are antithetical to biology (see above break-down).

excuse me, but DNA isn't digital. that's the biggest flaw with your description of "Genetic encryption". DNA is physical, it's an analog method of storing information (crude analogy that it is).now, if DNA was a CD or a hard drive you might have a point.The other flaw is that DNA is not encrypted by one nucleic acid and translated by another. You do know what nucleic acid is, right?And one last nitpick--how is something that is a double-helix, linear?

i had always thought of analog as being physical, whereas digital isn't in the same sense. apparently that's not quite right.what makes DNA store info in discrete "bits"? is each "bit" like the code for a protein?as to the encryption thing, I understood hoot mon's argument a little differently. I took it that he meant that the DNA chain encrypted itself (so it would be like "A" encrypts "A", which to me seems really ridiculous). I forgot about tRNA though (as to being translated by other nucleic acids).

that did. thanks.

this thread is not your personal pulpit for you to preach in.this thread is not about morality.this thread is not about rob's moral problems with learning.this thread is about abiogenesis--the evidence that supports or refutes it.i'm asking for a suspension. as soon as you come back, you start right again with the off-topic shit. enough's enough. you got a 3 hour warning. then a 6 hour warning. neither have done any good apparently.

so you're left to an argument of incredulity, essentially. it's incredibly improbable, hence, it didn't happen.that's a weak argument rob, very weak. especially when we have evidence that there once was no life on earth. and now there is. (which means that abiogenesis did happen--panspermia only shifts the question to where it happened, and saying god did it doesn't explain how he did it).oh, and the quote you cite is crap. why? here's why: (bolding mine)
which enzyme? or did he mean genome? at which point, it's still crap, but for a different reason.why would you use the human genome for abiogenesis? You wouldn't. all model's I'm aware of suggest a far more simpler genome. think of DNA/RNA a few hundred (if that) base pairs in length. Not one in the millions. So his argument (if he meant "genome") is bulk because it is misrepresenting what is being argued for. No one is arguing for the creation of the whole human genome except for by evolution.and by the way, what's so "complex" about
1/10^40,000? pretty simple mathematical statement to me.ABE:
and thank you for at least staying on topic. you are more than welcome to start your own thread about what got you suspended.Edited by kuresu, : No reason given.

false. we have several hypotheses. as to odds:
no, they wouldn't. quite frankly, I don't even think he's using "language" right. If anything, the language would be the nitrogenous bases--A,C,T,G. not the human enzyme or genome (and if he did mean those, then the lengths become very important, and it's much easier to build something small than large, and an enzyme is small).Furthermore, and enzyme isn't DNA. it is the product (now, at any rate), of translating the DNA.as to the in-between:
there's a huge mistake he's making. if I understand it right, he's actually arguing about the mathematical imposssibility of humans arising. problem is, we're here. so obviously we are possible.it also then seems like he's using a "chance alone" argument. we are not the result of chance alone. we are the result of random mutations (which is chance) and our environment (which is where natural selection comes in, and the non-chance part of ToE). It also seems like he's saying evolution is goal-oriented (as in, humans specifically are a goal). not too sure about that. if he is, that's bunk too, because evolution isn't driven to meet pre-defined goals (such as creating humans or pigs).he's also arguing about the impossibility of our specific genome (i think, that word enzyme has me confused). problem is, you can make a ton of single base mutations without affecting the function of proteins. this is because each amino acid (which makes up proteins) has 3 (i think) variations for the base sequence. the earliest evidence we have for life is from rocks that are about 3.8 billion years old. Also, we know the earth is about 4.5 billion years old. now, you might say "couldn't the evidence have been destroyed"? you'd have a good point. evidence however, also suggests that the really early earth was essentially a molten ball and went through multiple impacts--one of which gave us our moon (hypothesis there) and our iron core.all the models of abiogenesis we have need a relatively stable environment (that I'm aware of), and those massive impacts don't help that. also, being a molten ball is not exactly conducive to the creation of complex chemicals (that I'm aware of). so we have evidence of really early life, and evidence of really early earth-conditions that make life impossible. And I don't think anyone is seriously going to suggest that life was started when the earth was forming.

false on both accounts. First, a non sequiter is:
a statement (as a response) that does not follow logically from or is not clearly related to anything previously saidyour quote was arguing about the impossibility of the human genome arising. it is very relevant to argue that that argument is bunk because quite frankly, here we are.my response is also not an argument of incredulity, which is:
a statement based off of the inability to think something possible, esp. when it has been shown to be possible.how is my argument one of incredulity? it isn't. actually, it's not my argument. that was the argument put forward by your quote (as best I could understand it). I already unraveled it.And there are very few assumptions in my thread. you want to talk about rocks? go to RAZD's thread on the age of the earth (add link later). In fact, I just re-read my post. The only assumption I can find is my statement about people suggesting that life started at the same time the earth was forming (that they wouldn't). Of course, you might be able to include my bit about key chemicals for life not being able to survive, but that's merely because of my unfamiliarity with those chemicals and where they can survive. my assumption is that they wouldn't--the extreme heat would break apart the bonds of those chemicals i think (i know that proteins will unfold permanently if heated to specific temperatures. there are none that i'm aware of that could survive where the temperature is well above boiling).if I have any assumptions that are pertainent to abiogenesis, discuss them here. age of rocks is not.ABE:
i forgot about creatures living in deep sea vents, where the water is 400 degress celcius (750ish farenhiet). funny thing though--no boiling due to pressure. my question is, are there any models of abiogenesis occurring at these vents?Edited by kuresu, : No reason given.