Summations Only

This is a common creationist tactic. When you can't deal with the science, just start casting aspersions about evolution being a religion or evolution being the product of atheism. Attack the messenger so you don't have to deal with the message.

Honest observation should recognize that mutations continually increase genetic diversity in a population.

Once again, absolutely nothing of substance from creationists in the face of mountains of evidence for evolution.

Let's go back to our simple gene and see how mutation, selection, and speciation work. We will start with Species OG (for original gangster).

Species OG allele A
TTTTTTTTTTTTTTTTTTTT

Speciation begins by the creation of two isolated populations of the OG population so that we have Species A and Species B

Species A  allele A               Species B allele A
TTTTTTTTTTTTTTTTTTTT              TTTTTTTTTTTTTTTTTTTT

Mutation and selection occurs in each population, but since different mutations and selection pressures occur in each species they end up with different alleles:

Species A  allele B               Species B allele C
TTTTTTTTTTTTTTTTATTT              TTTTTTGTTTTTTTTTTTTT

Those separate species have now diverged, all through microevolution. This same process occurs again.

Species A  allele D               Species B allele E
TTCTTTTTTTTTTTTTATTT              TTTTTTGTTTTTTTGTTTTT

And it occurs again:

Species A  allele F               Species B allele G
TTCTTTTTGTTTTTTTATTT              TATTTTGTTTTTTTGTTTTT

And it occurs again:

Species A  allele H               Species B allele I
TTCTTATTGTTTTTTTATTT              TATTTTGTTTTCTTGTTCTT

Let's freeze time and compare these new species with the OG species

Species A  allele H               Species B allele I
TTCTTATTGTTTTTTTATTT              TATTTTGTTTTCTTGTTCTT
Species OG allele A               Species OG allele A
TTTTTTTTTTTTTTTTTTTT              TTTTTTTTTTTTTTTTTTTT

That is macroevolution. We have reached the genetic divergence seen between what you would call separate kinds, and it all occurs through microevolution. Macroevolution is the accumulation of microevolutionary events, and when they occur in populations that are not interbreeding it produces divergence over time.

Surely you realize that this is exactly what you are doing. As shown above, that results in diverse species with different genomes, otherwise known as macroevolution.

"Sure you can define anything to deny reality if you want."--FaithI told you. You are doing the very exact thing that you are accusing others of. Now you are trying to redefine species so that you can deny their existence. The alleles in my example have more differences than those found between chimp and human genes, and I would assume you would classify humans and chimps as separate species. That is exactly what my model does, and it results in macroevolution.

In fact, Darwin rushed his work to publication because Alfred Russell Wallace was about to publish nearly the same theory. They co-published and co-presented their theories, but Darwin's work was more complete and better presented so he got the laurels. If it weren't for Darwin publishing we would be calling it Wallacian Evolution, which really doesn't roll of the tongue.Alfred Russel Wallace - WikipediaIf Darwin and Wallace had not published their theories, then it was nearly inevitable that someone else would have discovered and published the very same theory in short order. As the evidence mounted the theory of evolution was an inevitable conclusion.

Yet another post where creationists can't address the facts.

What we are interested in is the criteria one uses to determine if two species belong to the same kind.

If the tree is false, then show me a primate that isn't a mammal.

The problem is that you deny examples where we can define them as separate species, such as humans and chimps. We define species as a population that is evolving together. How do you define "kinds"? Just because they can interbreed does not mean that they are interbreeding. Again, species are defined as an interbreeding population that is evolving together. If there is no interbreeding then they are not evolving together. When you see genetic divergence between the populations then that is evidence for and the definition of speciation.Edited by Taq, : No reason given.Edited by Taq, : No reason given.

Creationists claim that a species can not evolve past the "kind" barrier. Evolutionists make no claims about a hard species barrier that a population can not go beyond. That's the difference.Therefore, it is incumbent upon the creationists to define what this barrier is.

Then how do determine if two species belong to the same kind or not? So how do you determine if two species share a common ancestor?

Systematics demonstrates that all life shares a universal common ancestor. Since you reject this finding, you can't claim that you are using systematics.You still haven't given a single test for determining if two species share a common ancestor. You don't have a test for determining if an allele for a shared gene came from the original kind. Everything you have said is just an assertion without any test for detecting it.Edited by Taq, : No reason given.

Can you discuss this webpage?