Register | Sign In


Understanding through Discussion


EvC Forum active members: 65 (9164 total)
2 online now:
Newest Member: ChatGPT
Post Volume: Total: 916,913 Year: 4,170/9,624 Month: 1,041/974 Week: 0/368 Day: 0/11 Hour: 0/0


Thread  Details

Email This Thread
Newer Topic | Older Topic
  
Author Topic:   A test for claimed knowledge of how macroevolution occurs
Faith 
Suspended Member (Idle past 1474 days)
Posts: 35298
From: Nevada, USA
Joined: 10-06-2001


Message 346 of 785 (855339)
06-18-2019 5:58 PM
Reply to: Message 343 by Taq
06-18-2019 5:52 PM


Can you explain why the genetic differences between species is irrelevant in your model? Don't the genetic differences between species explain the physical differences between species within your model?
Differences between two unrelated species? You want to know why they are irrelevant? Isn't it obvious? To you they are related, that's why they aren't meaningless to you. The physical differences between species in my model might have an incidental interest, but it's your model that says they're genetically related, not mine.

This message is a reply to:
 Message 343 by Taq, posted 06-18-2019 5:52 PM Taq has replied

Replies to this message:
 Message 348 by Taq, posted 06-18-2019 6:07 PM Faith has replied

  
Faith 
Suspended Member (Idle past 1474 days)
Posts: 35298
From: Nevada, USA
Joined: 10-06-2001


Message 347 of 785 (855341)
06-18-2019 6:01 PM
Reply to: Message 345 by Taq
06-18-2019 5:56 PM


Why don't DNA sequences have any relevance in your model?
Are you saying that your model can't explain anything about genetics?
I said quite a bit about genetics in my post about the model. Did you miss it?

This message is a reply to:
 Message 345 by Taq, posted 06-18-2019 5:56 PM Taq has not replied

  
Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.6


Message 348 of 785 (855345)
06-18-2019 6:07 PM
Reply to: Message 346 by Faith
06-18-2019 5:58 PM


Faith writes:
Differences between two unrelated species? You want to know why they are irrelevant? Isn't it obvious? To you they are related, that's why they aren't meaningless to you.
Why would the differences between genomes be irrelevant for two species that are not related?
The physical differences between species in my model might have an incidental interest, but it's your model that says they're genetically related, not mine.
In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?

This message is a reply to:
 Message 346 by Faith, posted 06-18-2019 5:58 PM Faith has replied

Replies to this message:
 Message 350 by Faith, posted 06-18-2019 6:31 PM Taq has replied

  
Sarah Bellum
Member (Idle past 626 days)
Posts: 826
Joined: 05-04-2019


(1)
Message 349 of 785 (855347)
06-18-2019 6:13 PM
Reply to: Message 1 by Dredge
06-11-2019 2:51 AM


It appears that the original post of this thread says that something known to science isn't "really" known unless humans can duplicate it on a lab bench.
So things like plate tectonics and supernovae aren't really "scientific knowledge"?

This message is a reply to:
 Message 1 by Dredge, posted 06-11-2019 2:51 AM Dredge has not replied

  
Faith 
Suspended Member (Idle past 1474 days)
Posts: 35298
From: Nevada, USA
Joined: 10-06-2001


Message 350 of 785 (855349)
06-18-2019 6:31 PM
Reply to: Message 348 by Taq
06-18-2019 6:07 PM


In your model, what causes a chimp to give birth to a chimp and not a human?
It's got a chimp genome. Period.
Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?
\
It's got a chimp genome. Period.

This message is a reply to:
 Message 348 by Taq, posted 06-18-2019 6:07 PM Taq has replied

Replies to this message:
 Message 352 by Taq, posted 06-19-2019 10:44 AM Faith has replied

  
PaulK
Member
Posts: 17828
Joined: 01-10-2003
Member Rating: 2.5


(1)
Message 351 of 785 (855383)
06-19-2019 12:35 AM
Reply to: Message 342 by Faith
06-18-2019 5:48 PM


quote:
It's meaningless in my model.
That’s the problem. We have an observation crying out for explanation and your model has none. Ours does explain it.
quote:
There are all kinds of facts that can be ignored in contexts where they are irrelevant.
Ignoring evidence against your model by declaring it irrelevant is not exactly honest argument.

This message is a reply to:
 Message 342 by Faith, posted 06-18-2019 5:48 PM Faith has not replied

  
Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.6


Message 352 of 785 (855402)
06-19-2019 10:44 AM
Reply to: Message 350 by Faith
06-18-2019 6:31 PM


Faith writes:
It's got a chimp genome. Period.
That's not what I asked. Please answer the question.
In your model, what causes a chimp to give birth to a chimp and not a human? Is it because of the differences between the chimp and human genomes and the process of inheritance? How do you explain this phenomenon?

This message is a reply to:
 Message 350 by Faith, posted 06-18-2019 6:31 PM Faith has replied

Replies to this message:
 Message 354 by Faith, posted 06-19-2019 7:17 PM Taq has replied

  
Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.6


(1)
Message 353 of 785 (855406)
06-19-2019 11:32 AM


How does the creationist model explain this?
Let's look at a vital human gene, cytochrome c.
Below are the two coding sequences for cytochrome c in humans and chimps.
Human                    ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACC
Chimp                    ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCATACC
                         ******************************************************** ***

Human                    GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAG
Chimp                    GTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTCGGGCGGAAG
                         ************************************************** *********

Human                    ACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGG
Chimp                    ACAGGTCAGGCCCCTGGATATTCTTACACGGCCGCCAATAAGAACAAAGGCATCATCTGG
                         ******************** ******** ******************************

Human                    GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
Chimp                    GGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAA
                         ************************************************************

Human                    ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
Chimp                    ATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAA
                         ************************************************************

Human                    AAAGCTACTAATGAG
Chimp                    AAAGCTACTAATGAG
                         ***************
So how does the creationist model explain how out of 315 bases there are just 4 that are different between human and chimp? Why should we see two separately created species with such similar DNA?

Replies to this message:
 Message 355 by Faith, posted 06-19-2019 7:18 PM Taq has replied

  
Faith 
Suspended Member (Idle past 1474 days)
Posts: 35298
From: Nevada, USA
Joined: 10-06-2001


Message 354 of 785 (855437)
06-19-2019 7:17 PM
Reply to: Message 352 by Taq
06-19-2019 10:44 AM


In the creation model the question of the differences between chimp and human is utterly meaningless. The answer is the one I gave: the chimp gives birth to a chimp because it has a chimp genome. Human genetics has nothing to do with it. A chimp is a chimp, a human is a human.
Edited by Faith, : No reason given.

This message is a reply to:
 Message 352 by Taq, posted 06-19-2019 10:44 AM Taq has replied

Replies to this message:
 Message 356 by Taq, posted 06-20-2019 12:12 PM Faith has replied

  
Faith 
Suspended Member (Idle past 1474 days)
Posts: 35298
From: Nevada, USA
Joined: 10-06-2001


Message 355 of 785 (855438)
06-19-2019 7:18 PM
Reply to: Message 353 by Taq
06-19-2019 11:32 AM


Re: How does the creationist model explain this?
Similar design. Nothing else to say about it.

This message is a reply to:
 Message 353 by Taq, posted 06-19-2019 11:32 AM Taq has replied

Replies to this message:
 Message 357 by Taq, posted 06-20-2019 12:12 PM Faith has replied

  
Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.6


Message 356 of 785 (855524)
06-20-2019 12:12 PM
Reply to: Message 354 by Faith
06-19-2019 7:17 PM


Faith writes:
In the creation model the question of the differences between chimp and human is utterly meaningless.
Then the creation model can't model biology because genetic differences are a biological fact. If you can't explain what we see in genetics, then your model doesn't work.
More to the point, the evolutionary model can explain all of this.

This message is a reply to:
 Message 354 by Faith, posted 06-19-2019 7:17 PM Faith has replied

Replies to this message:
 Message 359 by Faith, posted 06-20-2019 12:22 PM Taq has replied

  
Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.6


Message 357 of 785 (855525)
06-20-2019 12:12 PM
Reply to: Message 355 by Faith
06-19-2019 7:18 PM


Re: How does the creationist model explain this?
Faith writes:
Similar design.
Did God start with a common design and make changes to it?

This message is a reply to:
 Message 355 by Faith, posted 06-19-2019 7:18 PM Faith has replied

Replies to this message:
 Message 358 by Faith, posted 06-20-2019 12:16 PM Taq has replied

  
Faith 
Suspended Member (Idle past 1474 days)
Posts: 35298
From: Nevada, USA
Joined: 10-06-2001


Message 358 of 785 (855527)
06-20-2019 12:16 PM
Reply to: Message 357 by Taq
06-20-2019 12:12 PM


Re: How does the creationist model explain this?
Faith writes:
Similar design.
Did God start with a common design and make changes to it?
No, each design is unique to the creature.
Scripture puts human beings in a completely separate category from animals in any case.

This message is a reply to:
 Message 357 by Taq, posted 06-20-2019 12:12 PM Taq has replied

Replies to this message:
 Message 360 by Taq, posted 06-20-2019 12:31 PM Faith has replied

  
Faith 
Suspended Member (Idle past 1474 days)
Posts: 35298
From: Nevada, USA
Joined: 10-06-2001


Message 359 of 785 (855530)
06-20-2019 12:22 PM
Reply to: Message 356 by Taq
06-20-2019 12:12 PM


In the creation model the question of the differences between chimp and human is utterly meaningless.
Then the creation model can't model biology because genetic differences are a biological fact.
Um, the creation model is all about genetic differences. Chimp bodies and human bodies are identifiable by their genetic differences as well as by morphology. I keep trying to figure out your thinking but all I know is that you are so tightly bound up in the ToE you can't grasp what I'm saying no matter how I put it.
I can try to say it again: The creation model certainly does model biology because it's all about genetic differences between the creatures.
If you can't explain what we see in genetics, then your model doesn't work.
But creationism DOES explain what you see in genetics. I'm astonished at your not seeing it.
More to the point, the evolutionary model can explain all of this.
So can the separate creation of each creature explain it.
Edited by Faith, : No reason given.
Edited by Faith, : No reason given.

This message is a reply to:
 Message 356 by Taq, posted 06-20-2019 12:12 PM Taq has replied

Replies to this message:
 Message 362 by Taq, posted 06-20-2019 12:34 PM Faith has replied
 Message 363 by ringo, posted 06-20-2019 12:34 PM Faith has not replied

  
Taq
Member
Posts: 10085
Joined: 03-06-2009
Member Rating: 5.6


Message 360 of 785 (855534)
06-20-2019 12:31 PM
Reply to: Message 358 by Faith
06-20-2019 12:16 PM


Re: How does the creationist model explain this?
Faith writes:
No, each design is unique to the creature.
Then why is 98% of the chimp genome identical to the human genome?

This message is a reply to:
 Message 358 by Faith, posted 06-20-2019 12:16 PM Faith has replied

Replies to this message:
 Message 361 by Faith, posted 06-20-2019 12:34 PM Taq has replied

  
Newer Topic | Older Topic
Jump to:


Copyright 2001-2023 by EvC Forum, All Rights Reserved

™ Version 4.2
Innovative software from Qwixotic © 2024